Find in Library

With numerous industrial applications, <i>Paenibacillus polymyxa</i> has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in <i>P. polymyxa</i> have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in <i>Paenibacillus</i> spp., which differs from that in the <i>Bacillus</i> spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter P<i>shuttle-09</i>. The eGFP fluorescence intensity assay indicated that both the modified and original P<i>shuttle-09</i> had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in <i>Paenibacillus</i> spp. that can dynamically regulate its gene circuit strength through xylose.